Εκπαιδευτικά νέα

Πανελλήνιες 2020: οι απαντήσεις στη Βιολογία

Απαντήσεις από τα Φροντιστήρια Πουκαμισάς

Δείτε τις  απαντήσεις στα θέματα από την ομάδα καθηγητών των Φροντιστηρίων Πουκαμισάς, μόλις αυτές είναι διαθέσιμες

Οι Απαντήσεις Βιολογίας - ΝΕΟ ΣΥΣΤΗΜΑ ΕΔΩ

Οι Απαντήσεις Βιολογίας  ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ - ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΔΩ  

Οι Απαντήσεις Βιολογίας ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ - ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ ΕΔΩ

ΑΝΑΤΛΥΤΙΚΑ ΟΙ ΑΠΑΝΤΗΣΕΙΣ της Βιολογίας για τους υποψηφίους με το ΝΕΟ ΣΥΣΤΗΜΑ 

ΘEMA Α

Α1: (β) στον σπλήνα, τις αμυγδαλές, τους λεμφαδένες και τον λεμφικό ιστό κατά μήκος του γαστρεντερικού σωλήνα.

Α2: (α) μόνο στα ευκαρυωτικά κύτταρα.

Α3: (δ) αποικοδόμησης.

Α4: (α) υπάρχουν φυσιολογικά στο ανθρώπινο γονιδίωμα.

Α5: (γ) παράγεται καθ’ όλη τη διάρκεια της ζωής του ανθρώπου.

ΘEMA Β     

Β1.

                                        Αριθμός χρωμοσωμάτων       Αριθμός μορίων DNA πυρήνα

Μετάφαση μίτωσης     48                                                           96

Θυγατρικό κύτταρο

που προκύπτει από την Μείωση Ι       24                                 48

 

Β2. Σχολικό βιβλίο Βιολογία Τεύχος Α (Γενικής Παιδείας). Σελ. 62 από «Η αιθυλική αλκοόλη..» έως «..καρδιαγγειακό σύστημα.»

Σελ. 63 από «Το πεπτικό σύστημα..» έως  «..στα μη εξαρτημένα από το αλκοόλ άτομα.»

Β3. (i) Σχολικό βιβλίο Βιολογία Τεύχος Α (Γενικής Παιδείας). Σελ. 13 από «Σε αντίξοες συνθήκες...» έως σελ. 14 «...το καθένα ένα βακτήριο.»

(ii) Σχολικό βιβλίο Βιολογία Τεύχος Β (Κατεύθυνσης). Σελ. 44 από «Οι ερευνητές περιέγραψαν...» έως σελ. 45 «...να καταστείλει τη λειτουργία των τριών γονιδίων.»

(iii) Σχολικό βιβλίο Βιολογία Τεύχος Β (Κατεύθυνσης). Σελ. 45 από «Στο γονιδίωμα των προκαρυωτικών οργανισμών...» έως «…της έκφρασής τους.» επομένως, αν δεν υπάρχουν αμινοξέα στο θρεπτικό υλικό των βακτηρίων, γίνεται ενεργοποίηση του οπερονίου βιοσύνθεσής τους, ώστε να καταφέρουν να επιβιώσουν.

Β4. Σχολικό βιβλίο Βιολογία Τεύχος Β (Κατεύθυνσης). Σελ. 98 από «Ο αλφισμός οφείλεται…» έως «…μειωμένη ενεργότητα.» Ο αλφισμός κληρονομείται με αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας και οφείλεται σε γονιδιακές μεταλλάξεις. Ανάλογα με το είδος της μετάλλαξης προκαλείται από μειωμένη ενεργότητα της παραγώμενης πρωτεΐνης έως πλήρη έλλειψή της. Αντίστοιχα τα συμπτώματα (φαινότυπος) κυμαίνονται από ήπια έως πολύ σοβαρά.

Β5. 5’ και 3’ αμετάφραστες περιοχές.

Κωδικόνια λήξης (ΤGA, ΤAA, ΤAG).

Περιοχές DNA που κωδικοποιούν για rRNA, tRNA.

ΘEMA Γ

Γ1. Καμπύλη Α: Μεγάλη συγκέντρωση αντιγόνων επομένως πρόκειται για πρωτογενή απόκριση.

Καμπύλη Β: Αιφνίδια εμφάνιση μεγάλης ποσότητας αντιγόνων τα οποία δεν πολλαπλασιάζονται, επομένως είναι πιθανώς εξασθενημένα, δηλαδή πρόκειται για χορήγηση εμβολίου και κατ επέκταση πρωτογενή απόκριση.

Καμπύλη Γ: Άμεση αντιμετώπιση του αντιγόνου, οπότε πρόκειται για δευτερογενή απόκριση

 Γ2. Γνωρίζουμε πως από το ένα τροφικό επίπεδο στο επόμενο περνάει μόνο το 10% της συνολικής βιομάζας ενός επιπέδου. Με βάση τα στοιχεία που μας δίνονται η συνολική βιομάζα των οργανισμών είναι Π:5.000kg, Κ:50.000kg, Λ:50kg, Σ: 500kg.

Επομένως η τροφική αλυσίδα διαμορφώνεται ως εξής: Κ - Π- Σ- Λ

Πυραμίδα βιομάζας                            Πυραμίδα Πληθυσμού

Λ 50 kg                                                         Λ 10

Σ 500 kg                                                       Σ 200

Π 5000 kg                                                    Π 20.000

Κ 50000 kg                                                  Κ 5

 Γ3. Στην άσκηση δεν διευκρινίζεται αν πρόκειται για πυρηνικό, ή μιτοχονδριακό γονίδιο, οπότε είμαστε υποχρεωμένοι να πάρουμε περιπτώσεις:

  1. Η ασθένεια οφείλεται σε αυτοσωμικό επικρατές γονίδιο: Ασθενής μητέρα ΑΑ / Αα, Υγιής πατέρας: αα. Πιθανότητα για ασθενή απόγονο 100% στην πρώτη περίπτωση και 50% στην δεύτερη.
  2. Η ασθένεια οφείλεται σε αυτοσωμικό υπολειπόμενο γονίδιο: Ασθενής μητέρα αα, Υγιής πατέρας: ΑΑ / Αα. Πιθανότητα για ασθενή απόγονο 0 στην πρώτη περίπτωση και 50% στην δεύτερη.
  3. Η ασθένεια οφείλεται σε μιτοχονδριακό γονίδιο: Όλοι οι απόγονοι απαραιτήτως θα πάσχουν.

 Γ4. Κατά τον ημισυντηρητικό τρόπο αντιγραφής η κάθε αλυσίδα χρησιμοποιείται ως καλούπι για τη σύνθεση μιας συμπληρωματικής. Αν το κύτταρο βρίσκεται σε περιβάλλον με ραδιενεργά νουκλεοτίδια, όλες οι καινούριες αλυσίδες που θα παραχθούν θα είναι ραδιενεργές.

 Επομένως με βάση τα παραπάνω:

 

Κύκλος αντιγραφής     0          1          2          3

Αριθμός μορίων          1          2          4          8

Αλυσίδες         2          4          8          16

Αλυσίδες με Ν14        2          2          2          2

Αλυσίδες με Ν15        -           2          6          14

 

Επομένως μετά το τέλος της αντιγραφής οι 14 από τις 16 (87,5%) αλυσίδες θα είναι ραδιενεργές, ενώ τα 6 από τα 8 μόρια θα έχουν αποκλειστικά ραδιενεργά νουκλεοτίδια (75%).

 

 

ΘΕΜΑ Δ

Δ1. Διερευνώντας τις τρεις αλληλουχίες παρατηρούμε πως στο γονίδιο Α υπάρχει κωδικόνιο έναρξης το οποίο με βήμα τριπλέτας οδηγεί σε κωδικόνιο λήξης

 

  1. 5’GAATTCGGAACATGCCCGGGTCAGCCTGAGAGAATTCCC3’
  2. 3’CTTAAGCCTTGTACGGGCCCAGTCGGACTCTCTTAAGGG 5’

 

mRNA

5’GAAUUCGGAACAUGCCCGGGUCAGCCUGAGAGAAUUCCC3’

 

Επομένως το γονίδιο Α μεταγράφεται σε mRNA.

 

Δ2. Παρατηρούμε πως στο γονίδιο Γ υπάρχει αλληλουχία αντίστοιχη με αυτή του tRNA της μεθειονίνης, επομένως αυτό αντιστοιχεί στο tRNA.

Αλ1. ACTATGCACTTCCGGCCAA

Αλ2. TGATACGTGAAGGCCGGTT

 

Μεταγραφόμενη αλυσίδα είναι η Αλ. 1

 

Δ3. Στο γονίδιο Β υπάρχει αλληλουχία συμπληρωματική με την 5’ αμετάφραστη περιοχή του mRNA οπότε πρόκειται για το γονίδιο που μεταγράφεται σε rRNA.

Αλ1. CTTATACGCAATGTTCCTAAA

Αλ2. GAATATGCGTTACAAGGATTT

Από τις 2 αλυσίδες η Αλ.1 είναι η μεταγραφόμενη

 

Δ4. i) Στο γονίδιο Α παρατηρούμε τις αλληλουχίες αναγνώρισης της EcoRI

 

  1. 5’GAATTCGGAACATGCCCGGGTCAGCCTGAGAGAATTCCC3’
  2. 3’CTTAAGCCTTGTACGGGCCCAGTCGGACTCTCTTAAGGG 5’

 Επίσης παρατηρούμε πως τα μονόκλωνα άκρα που αφήνει η ΠΕ1 είναι ίδια με αυτά που αφήνει EcoRI. Επομένως το τμήμα DNA θα κοπεί με την EcoRI και το πλασμίδιο με την ΠΕΙ

 1. ii) Μετά την επιτυχημένη ενσωμάτωση του τμήματος DNA οι αλληλουχίες που θα προκύψουν είναι: 5’ CAATTC 3’  και  5’ GAATTG 3’

                                    3’ GTTAAG 5’                       3’ CTTAAC 5’

 

iii) Η θέση αναγνώρισης της ΠΕ-Ι δεν υπάρχει στο ανασυνδυασμένο πλασμίδιο οπότε και η περιοριστική ενδονουκλεάση δεν θα το κόψει.

ΤΑ ΘΕΜΑΤΑ 

Δείτε τα θέματα της ΒΙΟΛΟΓΙΑΣ ΕΔΩ - ΝΕΟ ΣΥΣΤΗΜΑ 

Δείτε τα θέματα της ΒΙΟΛΟΓΙΑΣ  ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΔΩ - ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ 

Δείτε τα θέματα της ΒΙΟΛΟΓΙΑΣ  ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΕΔΩ - ΠΑΛΑΙΟ ΣΥΣΤΗΜΑ 

Διαβάστε ΕΔΩ όλα τα νέα για τις Πανελλήνιες

ΤΑ ΝΕΑ του neakriti.gr ΣΤΟ Google News

Τα δημοφιλέστερα του 24ώρου

Σχόλια